ID: 922739605_922739623

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 922739605 922739623
Species Human (GRCh38) Human (GRCh38)
Location 1:228007759-228007781 1:228007789-228007811
Sequence CCTGGGCCCCGCGCGCCTCCCCG CCGGGCACGGGGGTTTCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 99, 4: 780} {0: 1, 1: 0, 2: 1, 3: 8, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!