ID: 922748324_922748335

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 922748324 922748335
Species Human (GRCh38) Human (GRCh38)
Location 1:228059566-228059588 1:228059586-228059608
Sequence CCTGGGGGCGGGACTCCTCCCTG CTGGGGGTGGGGCTCCTACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 328} {0: 1, 1: 0, 2: 0, 3: 35, 4: 350}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!