ID: 922753812_922753827

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 922753812 922753827
Species Human (GRCh38) Human (GRCh38)
Location 1:228083123-228083145 1:228083164-228083186
Sequence CCTCTGCCTTTCTCGTTTCCCGA GGTTGGGATTAGCGGCCGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 208} {0: 1, 1: 0, 2: 0, 3: 3, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!