ID: 922754820_922754823

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 922754820 922754823
Species Human (GRCh38) Human (GRCh38)
Location 1:228089859-228089881 1:228089880-228089902
Sequence CCCAGCATGTCTGTGGTGAGTGT GTGTAGTTCAGGAAGTGAACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 17, 4: 153} {0: 1, 1: 0, 2: 1, 3: 13, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!