ID: 922808303_922808309

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 922808303 922808309
Species Human (GRCh38) Human (GRCh38)
Location 1:228401834-228401856 1:228401858-228401880
Sequence CCCAGGATGGGGCCCTTGCAGTA GGGAGCCCACGCCCACGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 834} {0: 1, 1: 1, 2: 0, 3: 14, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!