ID: 922821281_922821285

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 922821281 922821285
Species Human (GRCh38) Human (GRCh38)
Location 1:228487456-228487478 1:228487470-228487492
Sequence CCTGCGCCCTTGCCGGCCCCGCC GGCCCCGCCGCCCGCAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 74, 4: 568} {0: 1, 1: 1, 2: 17, 3: 111, 4: 691}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!