ID: 922922004_922922012

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 922922004 922922012
Species Human (GRCh38) Human (GRCh38)
Location 1:229313397-229313419 1:229313410-229313432
Sequence CCAGAGCCCCATTCCAGACCAGC CCAGACCAGCAGGCAGTGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 3, 3: 45, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!