ID: 923014019_923014026

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 923014019 923014026
Species Human (GRCh38) Human (GRCh38)
Location 1:230112153-230112175 1:230112200-230112222
Sequence CCAGGTGGCTGCTTTCTCCTCTC AGGACTCATGTGTCTACCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 61, 4: 439} {0: 1, 1: 0, 2: 1, 3: 14, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!