ID: 923015118_923015128

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 923015118 923015128
Species Human (GRCh38) Human (GRCh38)
Location 1:230120614-230120636 1:230120645-230120667
Sequence CCGATCTGCCCTTCCTTCCGCAG GACGCACAGCTCCCCAGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 271} {0: 1, 1: 0, 2: 20, 3: 436, 4: 4638}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!