ID: 923021527_923021537

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 923021527 923021537
Species Human (GRCh38) Human (GRCh38)
Location 1:230167789-230167811 1:230167825-230167847
Sequence CCTGCGGCTGCTCCACTGTGGCC CATCACCAAGTGCTGCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 248} {0: 1, 1: 0, 2: 1, 3: 14, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!