ID: 923022497_923022513

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 923022497 923022513
Species Human (GRCh38) Human (GRCh38)
Location 1:230175626-230175648 1:230175667-230175689
Sequence CCTCCTCCTCCTTTCCCTCTCCC CCTCCCCCTCCTTCTCCTTGGGG
Strand - +
Off-target summary {0: 2, 1: 20, 2: 254, 3: 1688, 4: 8120} {0: 1, 1: 0, 2: 9, 3: 87, 4: 803}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!