ID: 923104372_923104379

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 923104372 923104379
Species Human (GRCh38) Human (GRCh38)
Location 1:230843216-230843238 1:230843263-230843285
Sequence CCTCTGAGGAAGAGGCAGGGGAA CTGTGGCCTGCCTGCTTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 62, 4: 864} {0: 1, 1: 0, 2: 0, 3: 22, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!