ID: 923126030_923126033

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 923126030 923126033
Species Human (GRCh38) Human (GRCh38)
Location 1:231035335-231035357 1:231035369-231035391
Sequence CCCACTCTGCACAGGTGGGAGAC ATAGTTTAAAGAAAAAAATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 140} {0: 1, 1: 0, 2: 18, 3: 172, 4: 1619}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!