ID: 923149065_923149075

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 923149065 923149075
Species Human (GRCh38) Human (GRCh38)
Location 1:231217791-231217813 1:231217827-231217849
Sequence CCTAACCCCTTTGAGGGAGCAGC GAGAAGTGGAAAGTGCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 120} {0: 1, 1: 1, 2: 7, 3: 89, 4: 714}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!