ID: 923192520_923192523

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 923192520 923192523
Species Human (GRCh38) Human (GRCh38)
Location 1:231633515-231633537 1:231633538-231633560
Sequence CCCTGCTCATTGGGCTTCCACAT TTTGCTTCCTTCCCTTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 167} {0: 1, 1: 0, 2: 5, 3: 40, 4: 415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!