ID: 923206038_923206045

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 923206038 923206045
Species Human (GRCh38) Human (GRCh38)
Location 1:231759836-231759858 1:231759857-231759879
Sequence CCCTTAGTCATGGCCTCAATAAG AGAGAAGGGAGAAAGGACAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 86} {0: 1, 1: 1, 2: 30, 3: 341, 4: 1873}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!