ID: 923219473_923219477

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 923219473 923219477
Species Human (GRCh38) Human (GRCh38)
Location 1:231880200-231880222 1:231880231-231880253
Sequence CCCTCTCACCATGTGCTACCTTG CAGTGTCCCCAACAGCAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 49, 4: 386} {0: 1, 1: 10, 2: 90, 3: 274, 4: 836}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!