ID: 923276244_923276247

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 923276244 923276247
Species Human (GRCh38) Human (GRCh38)
Location 1:232399467-232399489 1:232399483-232399505
Sequence CCACACACCCTGTTCTTTCATCC TTCATCCCACTCTGCTCCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 420} {0: 1, 1: 0, 2: 5, 3: 20, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!