ID: 923339615_923339627

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 923339615 923339627
Species Human (GRCh38) Human (GRCh38)
Location 1:232996252-232996274 1:232996294-232996316
Sequence CCCGCAGCCACACCCCCCTGACT CACAAGTCACCTGGAAGTACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 408} {0: 1, 1: 0, 2: 0, 3: 6, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!