ID: 923375306_923375313

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 923375306 923375313
Species Human (GRCh38) Human (GRCh38)
Location 1:233356055-233356077 1:233356104-233356126
Sequence CCTTGGCACACGTTCTTTCCTCT TTCTGTGCCCATTTCATGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 379} {0: 1, 1: 0, 2: 1, 3: 30, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!