ID: 923470063_923470073

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 923470063 923470073
Species Human (GRCh38) Human (GRCh38)
Location 1:234282461-234282483 1:234282504-234282526
Sequence CCCTTGCTGTCTAACCAGGCTGC ACTTTTACTTAGCCTTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 154} {0: 1, 1: 0, 2: 2, 3: 29, 4: 383}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!