ID: 923629422_923629428

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 923629422 923629428
Species Human (GRCh38) Human (GRCh38)
Location 1:235640134-235640156 1:235640169-235640191
Sequence CCATGCATTCAGCCTGGGGAGGA CAGGCACATCATGCTTACGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 241} {0: 1, 1: 0, 2: 0, 3: 4, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!