ID: 923795187_923795192

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 923795187 923795192
Species Human (GRCh38) Human (GRCh38)
Location 1:237147315-237147337 1:237147339-237147361
Sequence CCCTATTTCTATTACTGTAAGAG AAAAGGGTGTGCACCTGTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 237} {0: 1, 1: 0, 2: 1, 3: 6, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!