ID: 923838036_923838041

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 923838036 923838041
Species Human (GRCh38) Human (GRCh38)
Location 1:237636277-237636299 1:237636325-237636347
Sequence CCTCTGTTGTTAACTGCTTTGTC CTGGGTAGACACTTAGTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 192} {0: 1, 1: 0, 2: 1, 3: 8, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!