ID: 923847517_923847524

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 923847517 923847524
Species Human (GRCh38) Human (GRCh38)
Location 1:237752279-237752301 1:237752320-237752342
Sequence CCCACCTGGGCCTACAGGTGCAC TTTTAGTTTTTTGTAGAGACAGG
Strand - +
Off-target summary No data {0: 32, 1: 1071, 2: 9937, 3: 52840, 4: 290058}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!