|
Left Crispr |
Right Crispr |
Crispr ID |
923847517 |
923847524 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:237752279-237752301
|
1:237752320-237752342
|
Sequence |
CCCACCTGGGCCTACAGGTGCAC |
TTTTAGTTTTTTGTAGAGACAGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 32, 1: 1071, 2: 9937, 3: 52840, 4: 290058} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|