ID: 923859427_923859431

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 923859427 923859431
Species Human (GRCh38) Human (GRCh38)
Location 1:237878155-237878177 1:237878183-237878205
Sequence CCTACCATTATTCTTGTTACCAG GTAAACAAGTTCCATGTTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 143} {0: 1, 1: 0, 2: 0, 3: 15, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!