ID: 923915019_923915028

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 923915019 923915028
Species Human (GRCh38) Human (GRCh38)
Location 1:238492262-238492284 1:238492311-238492333
Sequence CCAGTCCTTGGAGATGGATCTGG TTGGAGAACCAGCCTGAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 20, 3: 39, 4: 202} {0: 1, 1: 0, 2: 1, 3: 22, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!