ID: 923915023_923915028

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 923915023 923915028
Species Human (GRCh38) Human (GRCh38)
Location 1:238492288-238492310 1:238492311-238492333
Sequence CCATGAGAAATCTGAAGGCCAGC TTGGAGAACCAGCCTGAGGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!