ID: 924007820_924007824

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 924007820 924007824
Species Human (GRCh38) Human (GRCh38)
Location 1:239631561-239631583 1:239631600-239631622
Sequence CCTGTTCTTCTGCAAAGCCTGGC CTAGGTTAACCTTCTAATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 239} {0: 1, 1: 0, 2: 0, 3: 4, 4: 46}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!