ID: 924027224_924027229

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 924027224 924027229
Species Human (GRCh38) Human (GRCh38)
Location 1:239847045-239847067 1:239847091-239847113
Sequence CCTTCTGGTGTTCTACTCTGTCC TTATCATCTAATATGGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 185} {0: 1, 1: 0, 2: 1, 3: 12, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!