ID: 924037331_924037332

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 924037331 924037332
Species Human (GRCh38) Human (GRCh38)
Location 1:239950543-239950565 1:239950564-239950586
Sequence CCAATGCTGTGATGAAAAGTGTG TGAGCTCTGCTTCTCCCAGCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!