ID: 924071429_924071439

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 924071429 924071439
Species Human (GRCh38) Human (GRCh38)
Location 1:240284314-240284336 1:240284353-240284375
Sequence CCCTAATATGAGCCAATCTTTTA TGAGTTAGAAACAAACAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 178} {0: 1, 1: 0, 2: 0, 3: 20, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!