ID: 924074248_924074252

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 924074248 924074252
Species Human (GRCh38) Human (GRCh38)
Location 1:240316806-240316828 1:240316839-240316861
Sequence CCAGTTTTCCCCAATGATAGCAT TATAGTATAACATCAAAACCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 30, 3: 178, 4: 573} {0: 1, 1: 4, 2: 68, 3: 219, 4: 603}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!