ID: 924093334_924093341

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 924093334 924093341
Species Human (GRCh38) Human (GRCh38)
Location 1:240524962-240524984 1:240525014-240525036
Sequence CCAGCTACTGAGACACCGTGACC TTAGTTTTCTCTACTTCCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 52} {0: 1, 1: 3, 2: 293, 3: 522, 4: 807}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!