ID: 924133530_924133540

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 924133530 924133540
Species Human (GRCh38) Human (GRCh38)
Location 1:240938187-240938209 1:240938236-240938258
Sequence CCCTCCCACATCTGTGGATTTTT GTGGAAGTCATAAATAGAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 423} {0: 1, 1: 0, 2: 2, 3: 29, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!