|
Left Crispr |
Right Crispr |
Crispr ID |
924138518 |
924138523 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:240997706-240997728
|
1:240997738-240997760
|
Sequence |
CCCAGCTACTCAGGAGGCTGAGG |
CACGTGAATCCAGGAGACAGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 96881, 1: 202886, 2: 238913, 3: 154169, 4: 85070} |
{0: 2, 1: 36, 2: 1350, 3: 14416, 4: 44908} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|