ID: 924138518_924138523

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 924138518 924138523
Species Human (GRCh38) Human (GRCh38)
Location 1:240997706-240997728 1:240997738-240997760
Sequence CCCAGCTACTCAGGAGGCTGAGG CACGTGAATCCAGGAGACAGAGG
Strand - +
Off-target summary {0: 96881, 1: 202886, 2: 238913, 3: 154169, 4: 85070} {0: 2, 1: 36, 2: 1350, 3: 14416, 4: 44908}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!