ID: 924157883_924157887

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 924157883 924157887
Species Human (GRCh38) Human (GRCh38)
Location 1:241199903-241199925 1:241199941-241199963
Sequence CCTTTGACAGGTCATATAGCATG CTTCATCTGCAAAATGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 255} {0: 1, 1: 1, 2: 13, 3: 98, 4: 490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!