ID: 924205826_924205837

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 924205826 924205837
Species Human (GRCh38) Human (GRCh38)
Location 1:241710590-241710612 1:241710643-241710665
Sequence CCCAAAGGAGGATGGTTGTTAGT GGCCTGTGCAAAAGCTCTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 116} {0: 1, 1: 0, 2: 0, 3: 10, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!