ID: 924246852_924246857

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 924246852 924246857
Species Human (GRCh38) Human (GRCh38)
Location 1:242093635-242093657 1:242093672-242093694
Sequence CCATGTTGCCTCTGATCCTAAAG AAGAATTGTGTGCTTCACCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 219} {0: 1, 1: 0, 2: 1, 3: 7, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!