ID: 924281409_924281417

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 924281409 924281417
Species Human (GRCh38) Human (GRCh38)
Location 1:242440850-242440872 1:242440902-242440924
Sequence CCTTCACACTTCTAAAATCAGGT AATACAAAGAGAACTGGATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 155} {0: 1, 1: 0, 2: 4, 3: 49, 4: 612}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!