ID: 924389910_924389914

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 924389910 924389914
Species Human (GRCh38) Human (GRCh38)
Location 1:243543153-243543175 1:243543176-243543198
Sequence CCCACATGGTAGCTCCTGGCTGT CTTACTATCACCTTTACACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 60, 4: 668} {0: 1, 1: 0, 2: 1, 3: 13, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!