ID: 924483293_924483303

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 924483293 924483303
Species Human (GRCh38) Human (GRCh38)
Location 1:244455706-244455728 1:244455754-244455776
Sequence CCTATCTTAATGTACACATGAGA TGGGACTCCTTGGGAAAAACAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 24, 3: 66, 4: 262} {0: 13, 1: 20, 2: 18, 3: 48, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!