ID: 924546243_924546245

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 924546243 924546245
Species Human (GRCh38) Human (GRCh38)
Location 1:245030510-245030532 1:245030526-245030548
Sequence CCTCTCAGTGTACTGGAAGGACA AAGGACATTTATTGCCATTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 323} {0: 1, 1: 0, 2: 1, 3: 16, 4: 192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!