ID: 924568214_924568225

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 924568214 924568225
Species Human (GRCh38) Human (GRCh38)
Location 1:245215297-245215319 1:245215340-245215362
Sequence CCAGCATGACACGGTCCAGGTAA GGGAGGGTGTTTTCCAGGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 64} {0: 1, 1: 0, 2: 0, 3: 23, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!