ID: 924584549_924584556

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 924584549 924584556
Species Human (GRCh38) Human (GRCh38)
Location 1:245350586-245350608 1:245350629-245350651
Sequence CCTGGGACCATCAAAGCCCAGGT TTTCTAGCCAGCCATGCCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 189} {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!