ID: 924616718_924616726

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 924616718 924616726
Species Human (GRCh38) Human (GRCh38)
Location 1:245618028-245618050 1:245618048-245618070
Sequence CCTTTCCTCCCACCAAAGTCAGG AGGGTTACAGAAGGAAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 277} {0: 1, 1: 0, 2: 4, 3: 81, 4: 724}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!