ID: 924616723_924616727

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 924616723 924616727
Species Human (GRCh38) Human (GRCh38)
Location 1:245618037-245618059 1:245618051-245618073
Sequence CCACCAAAGTCAGGGTTACAGAA GTTACAGAAGGAAGAGAAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 9, 3: 96, 4: 932}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!