ID: 924625594_924625599

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 924625594 924625599
Species Human (GRCh38) Human (GRCh38)
Location 1:245694658-245694680 1:245694678-245694700
Sequence CCAGCGACCCCTCTGACTGCACG ACGCAGCTGTCAGCCAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 76} {0: 1, 1: 0, 2: 0, 3: 34, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!