ID: 924700614_924700618

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 924700614 924700618
Species Human (GRCh38) Human (GRCh38)
Location 1:246448452-246448474 1:246448474-246448496
Sequence CCCCAACATATCTACTGAGAGAC CTAAATAAACAAATGGTCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 127} {0: 1, 1: 0, 2: 10, 3: 75, 4: 630}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!