ID: 924813664_924813674

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 924813664 924813674
Species Human (GRCh38) Human (GRCh38)
Location 1:247424655-247424677 1:247424707-247424729
Sequence CCTCTTCACCATGTGCTTCATCC CTGAAACAGCAGATGGAGAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 257} {0: 1, 1: 1, 2: 5, 3: 34, 4: 375}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!